Fasta

From WikiMD's Wellness Encyclopedia


Overview[edit]

File:Chrysolina fastuosa (copula).ogv Fasta is a text-based format for representing nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.

History[edit]

The FASTA format was first introduced in the 1980s as part of the FASTA software package, which was developed for sequence alignment. The format has since become a standard in bioinformatics for sequence data exchange.

Format Description[edit]

A FASTA file begins with a single-line description, followed by lines of sequence data. The description line starts with a greater-than (>) symbol, followed by a sequence identifier and optional description. The sequence data follows, with each line typically not exceeding 80 characters.

Example[edit]

>sequence_1 Homo sapiens
ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC

Applications[edit]

FASTA format is widely used in bioinformatics for storing and sharing DNA, RNA, and protein sequences. It is compatible with many bioinformatics tools and databases, such as BLAST, GenBank, and UniProt.

Advantages[edit]

The simplicity and flexibility of the FASTA format make it easy to parse and manipulate. It is human-readable and can be easily edited with any text editor.

Limitations[edit]

FASTA format does not support rich metadata or annotations beyond the simple description line. For more complex data, formats like GenBank format or GFF may be more appropriate.

Related Pages[edit]

File:Chrysolina fastuosa01.jpg|Chrysolina fastuosa

Fasta gallery[edit]

Navigation: Wellness - Encyclopedia - Health topics - Disease Index‏‎ - Drugs - World Directory - Gray's Anatomy - Keto diet - Recipes

Ad. Transform your life with W8MD's Budget GLP-1 injections from $49.99


W8MD weight loss doctors team
W8MD weight loss doctors team

W8MD offers a medical weight loss program to lose weight in Philadelphia. Our physician-supervised medical weight loss provides:

NYC weight loss doctor appointmentsNYC weight loss doctor appointments

Start your NYC weight loss journey today at our NYC medical weight loss and Philadelphia medical weight loss clinics.

Linkedin_Shiny_Icon Facebook_Shiny_Icon YouTube_icon_(2011-2013) Google plus


Advertise on WikiMD

WikiMD's Wellness Encyclopedia

Let Food Be Thy Medicine
Medicine Thy Food - Hippocrates

Medical Disclaimer: WikiMD is not a substitute for professional medical advice. The information on WikiMD is provided as an information resource only, may be incorrect, outdated or misleading, and is not to be used or relied on for any diagnostic or treatment purposes. Please consult your health care provider before making any healthcare decisions or for guidance about a specific medical condition. WikiMD expressly disclaims responsibility, and shall have no liability, for any damages, loss, injury, or liability whatsoever suffered as a result of your reliance on the information contained in this site. By visiting this site you agree to the foregoing terms and conditions, which may from time to time be changed or supplemented by WikiMD. If you do not agree to the foregoing terms and conditions, you should not enter or use this site. See full disclaimer.
Credits:Most images are courtesy of Wikimedia commons, and templates, categories Wikipedia, licensed under CC BY SA or similar.