Fasta

FASTA is a bioinformatics software package used for sequence alignment of nucleotide or protein sequences. It was developed by David J. Lipman and William R. Pearson in 1985. The FASTA format is a text-based format for representing either nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.

History

FASTA was one of the first widely used algorithms for sequence alignment and database searching. It introduced the concept of using heuristics to speed up the process of finding similar sequences in large databases. The original FASTA algorithm was designed to search protein databases, but it was later adapted to search nucleotide databases as well.

Algorithm

The FASTA algorithm works by first identifying regions of similarity between sequences using a hash table of short words (k-tuples). These regions are then extended to form longer alignments. The algorithm uses a scoring system to evaluate the quality of the alignments, taking into account factors such as gap penalties and substitution matrices.

FASTA Format

The FASTA format is simple and consists of a header line followed by lines of sequence data. The header line starts with a ">" character and is followed by a sequence identifier and optional description. The sequence data is represented in a single-letter code, with each line typically containing up to 80 characters. Example of a FASTA format:

 >sequence1
 AGCTGATCGATCGTACGATCG
 >sequence2
 CGTAGCTAGCTAGCTAGCTAG
 

Applications

FASTA is widely used in bioinformatics for tasks such as:

• Sequence alignment
• Database searching
• Phylogenetic analysis
• Gene prediction

Related Software

FASTA has inspired the development of several other sequence alignment tools, including:

• BLAST
• Clustal
• MAFFT

See Also

• Sequence alignment
• Bioinformatics
• BLAST
• Clustal
• MAFFT
• Substitution matrix
• Gap penalty

External Links

   This article is a bioinformatics-related stub. You can help WikiMD by expanding it!