Fasta: Difference between revisions

From WikiMD's Wellness Encyclopedia

CSV import
CSV import
 
Line 35: Line 35:
[[Category:Bioinformatics]]
[[Category:Bioinformatics]]
[[Category:File formats]]
[[Category:File formats]]
File:Chrysolina fastuosa01.jpg|Chrysolina fastuosa
== Fasta gallery ==
<gallery>
File:Chrysolina fastuosa01.jpg|Chrysolina fastuosa
</gallery>

Latest revision as of 17:51, 3 March 2025


Overview[edit]

File:Chrysolina fastuosa (copula).ogv Fasta is a text-based format for representing nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.

History[edit]

The FASTA format was first introduced in the 1980s as part of the FASTA software package, which was developed for sequence alignment. The format has since become a standard in bioinformatics for sequence data exchange.

Format Description[edit]

A FASTA file begins with a single-line description, followed by lines of sequence data. The description line starts with a greater-than (>) symbol, followed by a sequence identifier and optional description. The sequence data follows, with each line typically not exceeding 80 characters.

Example[edit]

>sequence_1 Homo sapiens
ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC

Applications[edit]

FASTA format is widely used in bioinformatics for storing and sharing DNA, RNA, and protein sequences. It is compatible with many bioinformatics tools and databases, such as BLAST, GenBank, and UniProt.

Advantages[edit]

The simplicity and flexibility of the FASTA format make it easy to parse and manipulate. It is human-readable and can be easily edited with any text editor.

Limitations[edit]

FASTA format does not support rich metadata or annotations beyond the simple description line. For more complex data, formats like GenBank format or GFF may be more appropriate.

Related Pages[edit]

File:Chrysolina fastuosa01.jpg|Chrysolina fastuosa

Fasta gallery[edit]